Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circ-VANGL1 | |||
Gene | VANGL1 | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | Bladder Cancer | ICD-10 | Malignant neoplasm of Bladder, unspecified (C67.9) |
DBLink | Link to database | PMID | 30146736 |
Experimental Method | |||
Sample Type | Tissues and Cell lines | Comparison | BC with 87 cases and 37 cases of normal adjacent tissues |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward GTCCGCTCCACCGATGGCGA ReverseCTGAACTTCCTCTGTCCGAGT | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Zeng, Z, Zhou, W, Duan, L, Zhang, J, Lu, X, Jin, L, Yu, Y (2019). Circular RNA circ-VANGL1 as a competing endogenous RNA contributes to bladder cancer progression by regulating miR-605-3p/VANGL1 pathway. J. Cell. Physiol., 234, 4:3887-3896. |